• Users Online: 1073
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 
Table of Contents
RESEARCH ARTICLE
Year : 2021  |  Volume : 58  |  Issue : 2  |  Page : 115-118

First molecular survey of Anaplasma phagocytophilum in hard ticks (Ixodidae) from Southwestern Iran


1 Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz, Iran
2 Ms.C of Parasitology, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz, Iran

Date of Submission09-Sep-2018
Date of Decision28-Dec-2020
Date of Web Publication13-Jan-2022

Correspondence Address:
Hossein Hamidinejat
Professor, Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0972-9062.316273

Rights and Permissions
  Abstract 


Anaplasma phagocytophilum is a gram-negative obligate intracellular tick-borne rickettsia with veterinary and public health importance worldwide. This organism is an etiologic agent of tick-borne fever (TBF) in domesticated animals and human granulocytic anaplasmosis (HGA) as well. Hard ticks (Ixodida: Ixodidae) are incriminated as the main biologic vectors for Anaplasma spp. Studies represent that Ixodes spp. are the main vectors for A. phago-cytophilum and few reports hinted that other tick species may play this role. So, the goal of the presented work was to investigate the A. phagocytophilum in 2000 hard ticks in Khuzestan province of Iran by specific nested-PCR performing two consecutive amplifications of 16SrRNA gene fragment with highly variable nucleotide region. Each reaction included 10 salivary glands of distinct tick species. Specific nested-PCR on accumulated salivary glands detected specific bands in 15.5% of reactions (31 of 200) in electrophoresis only in Rhipicephalus sanguineous and Hyalomma marginatum ticks. We concluded that the broad distribution of A. phagocytophilum infection is not only is due to the existence of Ixodes spp. but other hard ticks may also play a role in this issue.

Keywords: Anaplasma phagocytophilum; Hard ticks; Nested-PCR; Iran


How to cite this article:
Hamidinejat H, Jallali MH, Bahrami S, Bagheri M. First molecular survey of Anaplasma phagocytophilum in hard ticks (Ixodidae) from Southwestern Iran. J Vector Borne Dis 2021;58:115-8

How to cite this URL:
Hamidinejat H, Jallali MH, Bahrami S, Bagheri M. First molecular survey of Anaplasma phagocytophilum in hard ticks (Ixodidae) from Southwestern Iran. J Vector Borne Dis [serial online] 2021 [cited 2022 Jan 29];58:115-8. Available from: https://www.jvbd.org/text.asp?2021/58/2/115/316273




  Introduction Top


Hard ticks (Ixodida: Ixodidae) are responsible for the transmission of many microbial infections due to its sanguinary biology[1]. In Middle East countries, ticks and tick-borne diseases are considerably prevalent because of the modality of the tropical and sub-tropical nature[2]. Many factors, for instance, numerous host species, the general condition of the hosts, and genetic diversities among the pathogenic organisms influence the ambiguous distribution of tick-borne diseases and make them intricate to control. Anaplasma phagocytophilum (Rickettsiales: Anaplasmataceae) is an emerging zoonotic tick-borne rickettsia, with veterinary and public health importance worldwide[3],[4]. This gram-negative obligate intracellular bacterium is well known as the etiologic agent of tick-borne fever (TBF) in domesticated animals including ruminants, dogs, and horses and human granulocytic anaplasmosis (HGA). Several wild animals are also infected with this rickettsia. This broad spectrum of reservoirs makes the organism with a spacious distribution pattern in mammalians including humans[4],[5]. Recent reports increasingly imply a worldwide prevalence of A. phagocytophilum in mentioned hosts[6]. Accordingly, A. phagocytophilum is reported hitherto from mammals of all European countries and also the United States[7]. In Iran, there are no available confirmative data or reports about human A. phagocytophilum infection but our previous surveys confirmed this organism in dogs and ruminants[5],[8],[9].

There is no confirmed detection of A. phagocytophilum in the salivary gland of vector ticks except the tracing DNA of this rickettsia. For this reason, among the different targeted genes for amplification in PCR, 16SrRNA gene fragment with highly variable nucleotide region appears more reliable for A. phagocytophilum detection[10]. Literature predominantly represented that A. phagocytophilum is transmitted by Ixodes spp. and there are few reports hinted that other ticks may also act as vectors[3]. Our molecular laboratory observations revealed that despite the absence of Ixodes spp. in the region of study, this bacterium is present in dogs, cows, and camels. Therefore, we aimed to investigate the existence of A. phagocytophilum and the probability of the circulating bacterium in salivary glands of predominant hard ticks in the Khuzestan province of Iran by a precise molecular method, i.e. specific nested PCR.


  Material & Methods Top


Sample collection

From January 2015 to June 2017, total 2000 of pre-dominant hard ticks, including 1000 Rhipicephalus sanguineous, 500 Hyalomma anatolicum anatolicum, and 500 H. marginatum were collected from cattle and sheep reared in different districts of Khuzestan province of Iran with 64.055 km2 area. The identification of selected ticks was done using the identification key published previously[11]. Afterward, individual ticks were dissected and their salivary glands were removed. Each 10 collected salivary glands from distinct tick species were pooled and preserved immediately in a tube with one ml of 70% ethanol until later molecular examination. Therefore, each positive or negative reaction in the molecular examination was representative of 10 accumulated salivary gland samples from a distinct tick species.

DNA extraction, PCR, nested PCR, and specific nested PCR

DNA was exploited by the application of the genomic DNA extraction Kit (Cinnagen, Iran). Species specification was accomplished by specific nested PCR according to amplification of the 16SrRNA gene which conserved for all Anaplasma species. PCR protocol and primer selection were adopted according to the previously described[12]. Briefly, amplification of the 16S rRNA gene was performed in 25μl reaction volumes including 5μl of DNA template, 5 pmol of forward and reverse primers (each 1μl), 12.5μl of master mix (Ampliqon, Denmark) containing 3mM MgCl2, 0.4mM of each dATP, dCTP, dGTP and dTTP and 0.08 U/ml Taq DNA polymerase in reaction buffer. PCR reactions included a negative control consisting of the reaction mix and 2 μl of DNase/ RNase-free water instead of DNA. Positive control consists of a DNA sample from the ticks that their infection to the A. phagocytophilum was confirmed with sequencing (accession number: MN795150). Forward and reverse genus-specific primer sequences were 5′AGAGTTTGATCCTGGCTCAG3′ and 5′AGCACTCATCGTTTACAGCG3′, respectively. The thermal cycles of PCR were as follows: 95°C for 5 min, 35 cycles of 94°C for 45 sec, annealing at 56°C for 45 sec, and 72°C for 45 sec, followed by a final extension step at 72°C for 5 min. Amplified products were identified using 2% of agarose gel stained by safe stain and compared with a 100bp ladder after visualization by UV transilluminator. Later stages were carried out on products of prime PCR by forward and reverse primers with 5′GCAAGCTTAACACATGCAAGTA 3′ and 5′ GTTAAGCCCTGGTATTTCAC 3′ for nested PCR to confirm the Anaplasma spp. and 5′ CTTTATAGCTTGCTATAAAGAA 3′ and 5′ GTTAAGCCCTGGTATTTCAC 3′ for specific nested PCR to confirm A. phagocytophilum. All of the circumstances for nested PCR and specific nested PCR including thermal program and detecting the products were identical to prime PCR.


  Results Top


In total, 31 samples of the approximately 781 bp length bands achieved by amplification of 16S rRNA gene of Anaplasma spp. in prime PCR [Figure 1]A were confirmed by detection of expected 544 bases pare length bands during the first nested-PCR [Figure 1]B and 509 bp length bands by subsequent specific nested-PCR [Figure 1]C. Specific nested-PCR on 200 accumulated salivary glands (each reaction includes 10 salivary glands of 10 distinct tick species) revealed that specific bands with 509 bp length bands were exhibited in 15.5% of cases (31 of 200) in electrophoresis. Positive results were relevant to R. sanguineous and H. marginatum and all of the stacked salivary glands from H. anatolicum anatolicum were negative for A. phagocytophilum infection; 21 of 50 pooled samples of H. marginatum and 10 of 100 pooled samples of R. sanguineous were clearly infected with this organism.
Figure 1: Agarose gel electrophoresis of PCR of the 16SrRNA gene (A), Nested PCR (B), and Specific Nested PCR (C) products. A. 1-6: 781 bp of amplified products of Anaplasma spp. B. 1-10: 543 bp of amplified products Anaplasma spp.in nested-PCR. C. 1-10: 509 bp of amplified products of A. phagocytophilum. P= Positive control. N= Negative control.

Click here to view



  Discussion Top


Anaplasmosis is an important issue for animal breeders in terms of economic losses as well as a health concern to humans. Ticks are considered as the main vector of the disease. The previous investigation showed that Ornithodoros lahorensis, H. dromedarii, H. anatolicum, H. asiaticum, H. marginatum, H. detritum, R. sanguineus, Dermacentor marginatus, D. niveus, and Argas persicus are considered as potential vectors for Anaplasma spp. in Iran[13]. Another study showed that R. sanguineus, R. bursa, Haemaphysalis punctata, and D. marginatus are the main vectors for A. ovis in Iran[14]. Although different studies showed the potential vectors for Anaplasma spp. in Iran there is very limited information about the possible vectors of A. phagocytophilum.

Our observation on successively achieved 781, 544 and 509 bp bands in gel electrophoresis following specific nested-PCR convinced that A. phagocytophilum infection was present among examined ticks, more in H. marginatum and less in R. sanguineous. Sampling was done from January till June in which hard ticks were at their annual peak in Khuzestan province in Iran. This region is enzootic for some veterinary tick-borne diseases, including theileriosis, babesiosis, and also anaplasmosis due to A. marginale. The outbreak of these diseases commonly occurs in later spring till mid summer[8],[9],[15],[16].

Our previous investigation showed that Iranian camels can be a reservoir of A. phagocytophilum and was found to be enzootic, as indicated by the high subclinical infection rate[8]. In Khuzestan province where the current study is carried out, we confirmed that the molecular prevalence of A. phagocytophilum was noticeably high in dogs[9]. Furthermore, we showed that 7.5% of cattle in Khuzestan province were infected with both A. phagocytophilum and A. marginale. We claimed that despite the healthy appearance of infected cattle, they may transmit Anaplasma to ticks and are potential continuous sources for maintaining and disseminating the organisms to the human and animals’ population[8].

Although most literature, but not all, suggests that predominantly Ixodes scapularis and I. ricinus tick species are the main vectors of A. phagocytophilum[3],[4], we confirmed again that other genera of hard ticks may act as potentially active vectors. Many reports relevant to Ixodes spp. as vectors of A. phagocytophilum are from Europe in which this tick is prevalent. Only in limited areas of Iran, far from the zone of sampling, Ixodes ricinus is present and there is no report that conveys the existence of I. scapularis or any other species of this genus. However, these areas are completely isolated by seamless mountains and there is no livestock exchange with the district of presented work. Except for Ixodes spp., this bacterium has been recognized by molecular approaches in different ticks from different countries, for instance, in H. longicornis, H. concinna, H. qinghaiensis, and D. silvarum in China[17]. Also, it was revealed that 13.7% of harvested R. sanguineous from dogs in Giza, Egypt were positive for A. phagocytophilum utilizing sequence analysis of the 16S rRNA gene and confirmed this tick species as a vector of this rickettsia[18]. Their report is confirmatory for our results. Worldwide distribution and considerable prevalence of tick-borne diseases such as TBF in domesticated animals and HGA in human populations indicate a wide range and also well-distributed tick vectors. It was revealed that Ixodes species are potentially active vectors of A. phagocytophilum in the northern hemisphere, especially in temperate zones. Just in Norway, the existence of A. phagocytophilum in host-seeking I. ricinus ranges from 1.4 % to 19.4 %[19],[20]. However, the scenario may be different in tropics and sub-tropics when this hard tick genus is absent.

The DNA of A. phagocytophilum was present in ticks of relatively all of the districts where we considered for sampling including boundaries of the province. Many ranchers of Khuzestan province have transhumance living in which they relocate to neighboring provinces with their livestock, mainly sheep and goats, on a seasonal basis. This lifestyle is traditional for the locals, but it, unfortunately, breaks the quarantine and makes the boundaries of the province unstable enzootic sites, where the naive animals experience an acute form of the diseases. The main problems and fatal cases of TBF are in animals that encounter the tick and rickettsia for the first time[4]. The first report of A. phagocytophilum infection was documented in two cattle by specific nested-PCR in the neighborhood of lodgment of nomadic tribes from Isfahan province in central Iran[12].

Anaplasma phagocytophilum infection is an emerging disease with increasing reports in both animals and humans all around the world. This broad distribution in infection is maintained by different potentially active vectors, maybe more than one genus of hard ticks. Here, we determined that A. phagocytophilum DNA existed in salivary glands of two predominant ixodid ticks, H. marginatum and R. sanguineous in Khuzestan province from Iran. In future studies, we will focus on A. phagocytophilum isolation from ticks and molecular identification and genetic analysis of isolated strains.

Conflicts of interest: None



 
  References Top

1.
Rodríguez Y, Rojas M, Gershwinm ME, Anaya JM. Tick-borne diseases and autoimmunity: A comprehensive review. J Autoimmun 2017; 88: 21–42.  Back to cited text no. 1
    
2.
Inci A, Yildirim A, Duzlu O, Doganay M, Aksoy S. Tick-borne diseases in Turkey: A review based on one health perspective. PLoS Negl Trop Dis 2016; 10(12): e0005021.  Back to cited text no. 2
    
3.
Severo MS, Stephens KD, Kotsyfakis M, Pedra JH. Anaplasma phagocytophilum: deceptively simple or simply deceptive? Future Microbiol 2012; 7(6): 719–731.  Back to cited text no. 3
    
4.
Stuen S, Granquist EG, Silaghi C. Anaplasma phagocytophilum – a widespread multi-host pathogen with highly adaptive strategies. Front Cell Infect Microbiol 2013; 3: 31.  Back to cited text no. 4
    
5.
Bahrami S, Hamidinejat H, Ganjali Tafreshi AR. First molecular detection of Anaplasma phagocytophilum in dromedaries (Camelus dromedarius). J Zoo Wildl Med 2018; 49(4): 844–848.  Back to cited text no. 5
    
6.
6- Ringo AE, Adjou Moumouni PF, Taioe M, Jirapattharasate C, Liu M, Wang G, Gao Y, Guo H, Lee SH, Zheng W, Efstratiou A, Li J, Inoue N, Suzuki H, Thekisoe O, Xuan X. Molecular analysis of tick-borne protozoan and rickettsial pathogens in small ruminants from two South African provinces. Parasitol Int 2017; 67(2): 144–149.  Back to cited text no. 6
    
7.
Strle F. Human granulocytic ehrlichiosis in Europe. I J Med Microbiol 2004; 37(12): 27–35.  Back to cited text no. 7
    
8.
Bahrami S, Hamidinejat H, Haji Hajikolaei MR, Kavianifar S. Concurrent occurrence of Anaplasma phagocytophilum and A. marginale in bovine peripheral blood samples from southwest of Iran. J Hell Vet Med Soc 2020; 71(3): 2301–2308.  Back to cited text no. 8
    
9.
Hamidinejat H, Bahrami S, Mosalanejad B, Pahlavan S. First molecular survey on Anaplasma phagocytophilum revealed high prevalence in rural dogs from Khuzestan province, Iran. Iran J Parasitol 2018; 14(2): 297–302.  Back to cited text no. 9
    
10.
Dumler JS, Barbet AF, Bekker CP, Dasch GA, Rikihisa Y, Rurangirwa FR et al. Reorganization of genera in the families Rickettsiaceae and Anaplasma taceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and “HGE agent” as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol 2001; 51(Pt 6): 2145–2165.  Back to cited text no. 10
    
11.
Estrada-Peña A, Bouattour A, Camicas J-L, Walker AR. Ticks of Domestic Animals in the Mediterranean Region: A Guide to Identification of Species. University of Zaragoza 2004.  Back to cited text no. 11
    
12.
Noaman V, Shayan P. Molecular detection of Anaplasma phagocytophilum in carrier cattle of Iran - first documented report. Iran J Microbiol 2009; 1: 37–42.  Back to cited text no. 12
    
13.
Tajedin L, Bakhshi H, Faghihi F, Telmadarraiy Z. High infection of Anaplasma and Ehrlichia spp. among tick species collected from different geographical locations of Iran. Asian Pac J Trop Dis 2016; 6(10): 787–792.  Back to cited text no. 13
    
14.
Pazhoom F, Ebrahimzade E, Shayan P, Nabian S. Anaplasma spp. identification in hard ticks of Iran: First report of Anaplasma bovis in Haemaphysalis inermis. Acarologia 2016; 56(4): 497–504.  Back to cited text no. 14
    
15.
Bahrami S, Ghadrdan AR, Pourmahdi Borujeni M, Vafayi Salarpur M. Epidemiology of Theileria equi in Persian Arab horses from Iran. Vet Med 2014; 59(9): 409–414.  Back to cited text no. 15
    
16.
Jalali SM, Bahrami S, Rasooli A, Hasanvand S. Evaluation of oxidant/antioxidant status, trace mineral levels, and erythrocyte osmotic fragility in goats naturally infected with Anaplasma ovis. Trop Anim Health Prod 2016; 48(6): 1175–1181.  Back to cited text no. 16
    
17.
Liu XY, Gong XY, Zheng C, Song QY, Chen T, Wang J, et al. Molecular epidemiological survey of bacterial and parasitic pathogens in hard ticks from eastern China. Acta Trop 2017; 167: 26–30.  Back to cited text no. 17
    
18.
Ghafar MW, Amer SA. Prevalence and first molecular characterization of Anaplasma phagocytophilum, the agent of human granulocytic anaplasmosis, in Rhipicephalus sanguineusticks attached to dogs from Egypt. J Adv Res 2012; 3: 189–194.  Back to cited text no. 18
    
19.
Rosef O, Radzijevskaja J, Paulauskas A, Haslekås C. The prevalence of Anaplasma phagocytophilum in host-seeking Ixodes ricinus ticks in Norway. Clin Microbiol Infect 2009; 15: 43–45.  Back to cited text no. 19
    
20.
Soleng A, Kjelland V. Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum in Ixodes ricinus ticks in Brønnøysund in northern Norway. Ticks Tick Borne Dis 2013; 4(3): 218–221.  Back to cited text no. 20
    


    Figures

  [Figure 1]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

  Material & M...
  In this article
Abstract
Introduction
Results
Discussion
References
Article Figures

 Article Access Statistics
    Viewed688    
    Printed8    
    Emailed0    
    PDF Downloaded46    
    Comments [Add]    

Recommend this journal