• Users Online: 550
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 
Table of Contents
SHORT RESEARCH COMMUNICATION
Year : 2021  |  Volume : 58  |  Issue : 1  |  Page : 90-93

Determination of cut-off of diagnostic ELISA for Scrub typhus in endemic setup: Central India


1 Division of In-vivo Research, ICMR-National Institute of Research in Tribal Health (NIRTH), Jabalpur, Madhya Pradesh, India
2 Division of Virology & Zoonoses, ICMR-National Institute of Research in Tribal Health (NIRTH), Jabalpur, Madhya Pradesh, India
3 Department of General Medicine, Netaji Subhash Chandra Bose Medical College, Jabalpur, Madhya Pradesh, India
4 Division of Genetic Disorder, ICMR-National Institute of Research in Tribal Health (NIRTH), Jabalpur, Madhya Pradesh, India
5 Division of Vector borne diseases, ICMR-National Institute of Research in Tribal Health (NIRTH), Jabalpur, Madhya Pradesh, India

Date of Submission05-Sep-2019
Date of Acceptance06-Nov-2019
Date of Web Publication18-Nov-2021

Correspondence Address:
Dr H V Manjunathachar
Division of In-vivo Research, ICMR-National Institute of Research in Tribal Health (NIRTH), Jabalpur-482003, Madhya Pradesh
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0972-9062.316272

Rights and Permissions
  Abstract 

Serology remains the mainstay for diagnosis of scrub typhus. In central India, diagnosis of this neglected emerging zoonotic disease suffers due to lack of standardized region-specific cutoff value and diagnostic test. Henceforth, standardized region-specific cutoff value for diagnostic ELISA play a significant role in initial treatment of patients and to differentiate other febrile diseases in endemic setup. A total of 144 patients of all age groups with acute undifferentiated febrile illness patients, forty healthy controls, dengue and chikungunya positive thirty-five samples in each category, respectively were enrolled in the study and subjected to IgM ELISA (InBioS, International, Inc.). Samples showing OD value more than 0.5 in IgM ELISA, were subjected to nested PCR. Both, receiver operating characteristic (ROC) curve and healthy volunteer samples mean with +3 SD were considered to generate region specific cutoff OD value. A total of 48 patients were diagnosed as cases of scrub typhus through IgM ELISA. Out of 48 samples, 30 were positive by nested PCR. The ROC curve analysis revealed a diagnostic ELISA cutoff value of 0.73 with sensitivity and specificity of 95% and 100%, respectively. The cut off arrived from healthy volunteer is mean OD + 3 SD is 0.72. Considering the significance of scrub typhus diagnosis for treatment and to understand disease dynamics in region wise, the cutoff value of >0.72 for diagnostic ELISA for Madhya Pradesh in central India can be used.

Keywords: Chiggerosis; Orientia tsutsugamushi; Diagnostic ELISA; Madhya Pradesh; Scrub typhus; Zoonoses


How to cite this article:
Manjunathachar H V, Barde PV, Raut C G, Tiwari P, Chouksey V, Gowda K, Kumar R, Das A. Determination of cut-off of diagnostic ELISA for Scrub typhus in endemic setup: Central India. J Vector Borne Dis 2021;58:90-3

How to cite this URL:
Manjunathachar H V, Barde PV, Raut C G, Tiwari P, Chouksey V, Gowda K, Kumar R, Das A. Determination of cut-off of diagnostic ELISA for Scrub typhus in endemic setup: Central India. J Vector Borne Dis [serial online] 2021 [cited 2021 Nov 27];58:90-3. Available from: https://www.jvbd.org/text.asp?2021/58/1/90/316272

In India, due to wide variation in geographical, ethnical, population and disease dynamics, clear-cut region-specific cut-off value for diagnostic ELISA is essential in initial treatment of patients in the absence of other rapid diagnostic tests for scrub typhus. Scrub typhus is a systemic, life-threatening zoonotic disease responsible for acute undifferentiated febrile illness, globally. The causal agent, Orientia tsutsugamushi is an obligate intracellular gram-negative coccobacillus, transmitted to humans by the bite of larval stage (chiggers) of the trobiculid mites, mostly Leptotrobidium spp[1]. Originally, this disease was thought to be confined to the ‘tsutsugamushi triangle ‘which extends from west Pakistan region to far eastern Russia in the east and northern Australia in the south. Although the exact burden of disease remains unclear, it threatens more than a billion people and an estimated one million cases are recorded worldwide per year with substantial mortality[2]. Currently, widespread re-emergence of diseases is noticed in different parts of India, Micronesia and Maldives islands, where it had been remarkably neglected[1],[2]. Classically, clinical signs begin with appearance of eschar at the site of mite feeding, pyrexia, exanthematous rash, myalgia and diffuse lymphadenopathy. Clinical spectrum of the diseases can range from mild, self-limiting to fatal illness in 30–50 % of those untreated[3].

The World Health Organization (WHO) designates scrub typhus as one of the most underdiagnosed and under-reported febrile illness requiring hospitalization. Since the disease shares common clinical signs with other tropical endemic illness like dengue, chikungunya, malaria, typhoid, leptospirosis and viral hemorrhagic fevers, this makes it difficult to distinguish the disease based on clinical signs alone. Henceforth, diagnosis relies heavily on laboratory tests[4],[5]. Though, Immunofluorescence test (IFT) is considered as gold standard, Immunoglobulin-M (IgM) ELISA remains mainstay of diagnosis in most centers in India, as it provides similar sensitivity to IFT and is technically feasible[6],[7]. However, due to change in populations, geographic locations and strains, disease diagnosis remains a major concern for health authorities to initiate therapy. Presently, health authorities are facing biggest challenge for diagnosis of scrub typhus in central India due to unavailability of a standardized cutoff of diagnostic ELISA. Henceforth, this study was undertaken to determine geographical relevant cutoff for IgM ELISA in Madhya Pradesh state of India.

A prospective diagnostic study was conducted at Indian Council of Medical Research (ICMR)-National Institute of Research in Tribal Health, Jabalpur, Madhya Pradesh. The study was conducted between July 2018 to November 2018. Following DHR (Department of Health Research, Gov. of India)-ICMR case definition for clinical cases, total of 144 patients of all age groups from Jabalpur and adjoining 10 districts with acute undifferentiated febrile illness of 2 days or more with or without eschar and other signs like headache and rash, lymphadenopathy, acute respiratory distress patients were enrolled in the study after taking proper consent[7]. Serum and whole blood samples were collected from all the patients following standard biosafety precautionary measures. An indirect ELISA (InBioS International, Inc.) was performed on all the serum samples to detect IgM antibodies against O. tsutsugamushi. Further, serum samples from forty healthy controls, and endemic diseases like dengue and chikungunya positive thirty-five samples in each category were also subjected to IgM ELISA as per the kit protocol. The absorbance was measured at 450 nm using a microplate reader (Thermo Scientific Multiskan FC). A standard nested PCR assay was carried out on the whole blood sample as described by Furuya et al[8]. DNA was extracted from the whole blood using DNASure Blood Mini Kit (Nucleopore, GENETIX, India) in accordance with the manufacturer instructions and used as a template for the PCR. For PCR, targeting O. tsutsugamushi-specific 56-kDa gene, external primer pairs, 5′- ATTGCTAGTGCAATGTCTGC -3′ and 5′- CTGCTGCTGTGCTTGCTGCG -3′ and internal primer pairs 5′- CCTCAGCCTACTATAATGCC -3′ and 5′- CGACAGATGCACTATTAGGC -3′ were used for amplification. For both PCR runs, the amplification protocol consisted of denaturation of template at 95°C for 45s, annealing at 58°C for 50 s followed by extension at 70°C for 1 min for 35 cycles and 5 μL of 1:10 diluted primary PCR product was used in secondary PCR. After amplification, PCR products were visualized on 1.5 % Agarose gel (Product size - 487 bp). Patients were classified as reactive and non-reactive based on the positivity by PCR or detection of IgM antibodies and rapid refervescence upon treatment with doxycycline was taken as positive. A receiver operating characteristic (ROC) curve was drawn as per the recommendations from kit literature by plotting OD values of all the samples. It was also calculated by adding three standard deviations to the mean optical density (OD) value of ELISA run on the samples of healthy volunteers.

Out of 144 patients, 48 were diagnosed as cases of scrub typhus through IgM ELISA. Among 48 IgM positive cases, 30 were positive by nested PCR targeting 56kDa gene [Figure 1]. A set of 40 sera collected from healthy volunteers, 35 positive samples from dengue as well as chikungunya cases respectively from different regions of Madhya Pradesh were used to establish region specific cutoff for scrub typhus IgM ELISA. The ROC curve analysis of 144 patients revealed a cutoff-OD value of 0.73 with sensitivity and specificity of 95% and 100%, respectively with confidence interval (CI) of 95% and significance <0.0001 [Figure 2]. The cut off calculated from healthy volunteer was mean OD (0.21) + 3 standard deviation (0.17) = 0.72. Among 144 samples subjected to IgM ELISA, 11 samples showing OD value between 0.5 to 0.7 were subjected to nested PCR and none found positive for scrub typhus.
Figure 1: Nested PCR amplification results of 56 kDa gene of samples from some IgM positive scrub typhus patients (lane M- 100 bp ladder marker, lane 1- positive sample karp strain, lane 2 to 4- IgM positive patient samples).

Click here to view
Figure 2: ROC curve analysis of scrub typhus IgM positive cases.

Click here to view


Chiggerosis is transmitted by bite of infected larvae of the mite Leptotrobidium spp. where human acts as an accidental dead-end host. India is an integral part of endemic zone i.e tsutsugamushi triangle. However, due to frequent outbreaks encountered in recent years in different parts of the country, it is described as a re-emerging infectious disease in India[9]. Generally, scrub typhus is an occupational disease among forest dwellers, tribes, farmers and those involved in recreational activities in scrub vegetated area in the Asia-pacific region[10]. It is considered as one of the most prevalent, severe and under-recognized but easily treatable disease in the world[3]. In this scenario, early diagnosis and prompt treatment can reduce morbidity and mortality due to this infectious disease[9].

Immunofluorescent antibody assay (IFA) is considered a gold standard test. Still, due to its high cost, requirement of technical expertise and unavailability of fluorescent microscopes in rural/tribal areas, limits its wide use in countries like India for routine diagnostic purpose[9]. Further, recently published DHR-ICMR guidelines for the diagnosis and management of rickettsial diseases in India discourages utility of rapid tests for diagnosis of scrub typhus as they need further evaluation[7]. Hence, IgM ELISA plays an important role in sero-prevalence studies to determine the disease dynamics as well as reference assay and point of care testing to initiate treatment against scrub typhus[6],[11],[12]. Wide array of endemic patterns of the disease and antigenic variations recorded in different parts of India demands geographic based cut-off value for diagnosis. In this direction, ICMR recommended a cutoff value of 0.5[7]. However, using uniform cutoff value across the nation is not feasible due to wide difference in geographic regions, differences in patient characteristics and endemicity rates. Henceforth, several studies from India have derived region-specific cut-off value ranging from 0.5 to 1 for diagnostic ELISA and used as a baseline for treatment of scrub typhus in different regions viz, New Delhi - 0.87 or 0.89, Himachal Pradesh - 0.46 or 0.5, Karnataka - 1.0 and Puducherry - 0.56[5],[11],[12],[13]. Few of these studies indicated the problems associated with high background antibody titers and the need to adjust the cut-off based on the endemicity and the reference assays in order to reduce false positivity. The PCR assay has proven useful for the early diagnosis of scrub typhus. Since, it will detect O. tsutsugamushi infection even before the appearance of specific antibodies in the blood, it is considered both sensitive and specific in detecting O. tsutsugamushi infection[14],[15],[16]. Kim et al[16] compared nested PCR results with the IFA, the gold standard assay and reported blood PCR remains positive in the patients up to 11 days even after the administration of antibiotics. Blacksell et al[17] estimated the accuracy of the InBios™ IgM ELISA to determine the OD cut-off values for the diagnosis of scrub typhus in Bangladesh by comparing with all reference assays (i.e., PCR, IFA ≥1:3200 or 4-fold rise to ≥3200, combination of PCR and IFA positivity). They compared ELISA results with all reference tests and indicated the most appropriate cut-off OD to be within the range of 0.75–1.25. Using the uniform cut-off value or lowering the diagnostic cutoff value may rise the risk of false positivity[17]. Currently, the region is endemic for tropical diseases like malaria, dengue and chikungunya. Clinicians encounter that it is difficult to distinguish different tropical diseases. So far there is no region-specific cutoff value for scrub typhus diagnostic ELISA in this region to start initial treatment of patients and to differentiate from other endemic febrile illness. So, we propose the cutoff OD value of >0.72 for Madhya Pradesh, by comparing InBios™ IgM ELISA with the one reference test (PCR assay). This state holds 1st rank among all the states/union territories of India in terms of Scheduled Tribe (ST) population of the country. Due to lack of disease endemicity data in this geographical region, all the patients cut off OD value more than 0.5 were subjected to PCR. Interestingly, 11 samples with OD values ranging from 0.5 to 0.72 were found negative for nested PCR. The sample OD value above 0.72 found positive for PCR and same cases were followed up and recorded non-defervescence after doxycycline treatment. It may be due to cross-reacting antibodies with related infectious agents such as other intracellular pathogens or non-specific immune stimulation and/or residual antibodies that may rise the OD value. Hence the cutoff value for diagnostic ELISA for Madhya Pradesh need to be considered as >0.72 rather than 0.5. The proposed cutoff value may act as a guide for differential diagnosis of tropical endemic diseases as well as treatment of suspected scrub typhus patients, through the seroconversion may vary time to time within the geographic setup.

Ethical statement

Approval of the study was obtained from Institutional Ethics Committee (IEC) (IEC No. 201801).

Conflict of interest: None

 
  References Top

1.
Varghese GM, Mathew A, Kumar S, Abraham OC, Trowbridge P, Mathai E. Differential diagnosis of scrub typhus meningitis from bacterial meningitis using clinical and laboratory features. Neurol India 2013; 61(1): 17–20.  Back to cited text no. 1
    
2.
Kelly DJ, Fuerst PA, Ching WM, Richards AL. Scrub typhus: the geographic distribution of phenotypic and genotypic variants of Orientiatsutsugamushi. Clin Infect Dis 2009; 48: (Suppl 3): 203–230.  Back to cited text no. 2
    
3.
Kawamura A, Tanaka H. Rickettsiosis in Japan. Jpn J Exp Med 1988; 58: 169–184.  Back to cited text no. 3
    
4.
Viswanathan S, Muthu V, Iqbal N, Remalayam B, George T. Scrub Typhus Meningitis in South India-A Retrospective Study. PLoS One 2013; 8(6): e66595.  Back to cited text no. 4
    
5.
Koraluru M, Bairy I, Varma M, Vidyasagar S. Diagnostic validation of selected serological tests for detecting scrub typhus. MicrobiolImmunol 2015; 59(57): 371–4.  Back to cited text no. 5
    
6.
Blacksell SD, Bryant NJ, Paris DH, Doust JA, Sakoda Y, Day NP. Scrub typhus serologic testing with the indirect immunofluorescence method as a diagnostic gold standard: a lack of consensus leads to a lot of confusion. Clin Infect Dis 2007; 44(3): 391–401.  Back to cited text no. 6
    
7.
Rahi M, Gupte MD, Bhargava A, Varghese GM, Arora R. DHR-ICMR guidelines for diagnosis & management of Rickettsial diseases in India. Indian J Med Res 2015; 141(4): 417–22.  Back to cited text no. 7
    
8.
Furuya Y, Yoshida Y, Katayama T, Yamamoto S, Kawamura A Jr. Serotype specific amplification of Rickettsia tsutsugamushi DNA by nested polymerase chain reaction. J Clin Microbiol 1993; 31(6): 1637–40.  Back to cited text no. 8
    
9.
Shivalli S. Diagnostic evaluation of rapid tests for scrub typhus in the Indian population is needed. Infectious Diseases of Poverty 2016; 5(1): 40  Back to cited text no. 9
    
10.
Silpapojakul K. Scrub typhus in the Western Pacific region. Ann Acad Med Singapore 1997; 26(6): 794–800.  Back to cited text no. 10
    
11.
Gupta N, Chaudhry R, Thakur CK. 2016. Determination of Cutoff of ELISA and Immunofluorescence Assay for Scrub Typhus. J Glob Infect Dis 2016; 8(3): 97–99.  Back to cited text no. 11
    
12.
Gupta A. Determination of Cutoff of IgM ELISA for Diagnosis of Scrub typhus in Hilly Northern State of Himachal Pradesh. PSM Microbiol 2018; 3(1): 1–3.  Back to cited text no. 12
    
13.
Anitharaj V, Stephen S, Pradeep J, Park S, Kim SH, Kim YJ, et al. Serological Diagnosis of Acute Scrub Typhus in Southern India: Evaluation of InBios Scrub Typhus Detect IgM Rapid Test and Comparison with other Serological Tests. J ClinDiagn Res 2016; 10(11): DC07–DC10.  Back to cited text no. 13
    
14.
Manosroi J, Chutipongvivate S, Auwanit W, Manosroi A. Early diagnosis of scrub typhus in Thailand from Clinical specimens by nested Polymerase Chain Reaction. Southeast Asian J Trop Med Public Health 2003; 34(4): 831–8.  Back to cited text no. 14
    
15.
Kim DM, Yun NR, Yang TY, Lee JH, Yang JT, Shim SK, et al. Usefulness of nested PCR for the diagnosis of scrub typhus in clinical practice: A prospective study. Am J Trop Med Hyg 2006; 75(3): 542–5.  Back to cited text no. 15
    
16.
Chunchanur SK. Scrub Typhus in India-An Impending Threat. Ann ClinImmunolMicrobiol 2018; 1(1): 1003  Back to cited text no. 16
    
17.
Blaksell SD, Kingston HWF, Tanganuchitcharnchai A, Phanichkrivalkosil M, Hossain M, Hossain A, et al. Diagnostic Accuracy of the InBios Scrub Typhus Detect™ ELISA for the Detection of IgM Antibodies in Chittagong, Bangladesh. Trop Med Infect Dis 2018; 3(3): 95.  Back to cited text no. 17
    


    Figures

  [Figure 1], [Figure 2]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
References
Article Figures

 Article Access Statistics
    Viewed454    
    Printed0    
    Emailed0    
    PDF Downloaded19    
    Comments [Add]    

Recommend this journal