• Users Online: 506
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 
Table of Contents
RESEARCH ARTICLE
Year : 2021  |  Volume : 58  |  Issue : 1  |  Page : 85-89

Prevalence of sibling-species of Anopheles (Cellia) fluviatilis complex in Himachal Pradesh, India


1 Environmental Epidemiology Division, ICMR-National Institute of Malaria Research, New Delhi, India
2 Kangra Study Site, ICMR-National Institute of Malaria Research, New Delhi, India

Date of Submission12-Jul-2019
Date of Acceptance10-Jun-2020
Date of Web Publication18-Nov-2021

Correspondence Address:
Dr R C Dhiman
Environmental Epidemiology Division, Indian Council of Medical Research-National Institute of Malaria Research, Dwarka Sector 8, New Delhi-11007
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0972-9062.321745

Rights and Permissions
  Abstract 

Background & objectives: Malaria is one of the most infectious and life-threatening vector borne disease in the tropics. Climate change can significantly influence malaria epidemiology and expansion of malaria vectors to hilly regions of Himachal Pradesh in India, hitherto considered areas of low transmission. Entomological surveillance in Kangra district of Himachal Pradesh revealed high density of a proven efficient vector of malaria, Anopheles fluviatilis, but transmission intensity of malaria was found very low. It was therefore considered prudent to investigate the sibling-species composition of An. fluviatilis complex in Kangra valley to ascertain their role in transmission of malaria.
Methods: The study was undertaken in six villages in Kangra district of Himachal Pradesh, India. A total of 4446 mosquitoes were collected during the one-year study period (2018) and processed in pools of ten for molecular characterization. DNA extraction and multiplex PCR was performed on 900 An. fluviatilis mosquitoes for differentiation of sibling-species. ELISA was used to detect Plasmodium falciparum and Plasmodium vivax circumsporozoite proteins in 3790 An. fluviatilis samples.
Results: Among prevalent mosquito species, An. fluviatilis was the predominant species constituting 69.5% of total mosquito collection. Sibling-species U was found in 92.22% and species T in 7.78% samples assayed. ELISA confirmed the absence of evidence of malaria parasite in any of the An. fluviatilis mosquitoes screened. Based on the difference in the sequences of conserved regions of the 28SrDNA, sibling-species U was confirmed as prevalent in the study villages.
Interpretation & conclusion: Study revealed that in Kangra district, An. fluviatilis sibling-species U is predominant followed by species T, and both are non-vectors. The absence of malaria parasite and zoophagic nature of An. fluviatilis established through blood meal analysis, confirmed that both U and T are non-vector sibling-species.

Keywords: Malaria; Anopheles fluviatilis; sibling-species; ELISA; PCR; Himachal Pradesh


How to cite this article:
Singh T, Hussain SS, Rawat M, Kar NP, Pasi S, Dhiman R C. Prevalence of sibling-species of Anopheles (Cellia) fluviatilis complex in Himachal Pradesh, India. J Vector Borne Dis 2021;58:85-9

How to cite this URL:
Singh T, Hussain SS, Rawat M, Kar NP, Pasi S, Dhiman R C. Prevalence of sibling-species of Anopheles (Cellia) fluviatilis complex in Himachal Pradesh, India. J Vector Borne Dis [serial online] 2021 [cited 2021 Nov 27];58:85-9. Available from: https://www.jvbd.org/text.asp?2021/58/1/85/321745


  Introduction Top


Malaria poses a major public health problem worldwide with significant morbidity and mortality. A total of 219 million malaria cases occurred globally in 2017, of which India alone contributed 844,558 (~4%) malaria cases[1]. There are six main malaria vectors in southeast Asia namely; An. fluviatilis, An. minimus, An. dirus, An. culicifacies, An. stephensi and An. sundaicus[2]. They are known to be complexes of cryptic species which are morphologically identical but differ in their biological and genetic characteristics and hence referred to as sibling-species[3].

Anopheles fluviatilis is an important vector in foothills of the Himalayan region and it breeds in slow running water[4]. Based on differences in distribution pattern, feeding preferences, disease transmission and polytene chromosome analyses of An. fluviatilis complex, they are classified into sibling-species S, T, and U[5]. Species S is considered a highly efficient vector of malaria unlike species T and U, which are considered as non-vectors[5].

While working at the field unit of the National Institute of Malaria Research in Kangra, Himachal Pradesh, we found a high prevalence of An. fluviatilis (69.5%) in field-collected mosquitoes. In the Kangra valley, higher temperatures at comparatively lower altitudes make the conditions suitable for malaria transmission and it can be categorized as hotspot of malaria transmission in the foreseeable future. Despite the high density of An. fluviatilis in the district, malaria transmission remained at low ebb [Supplementary Table S1] [Additional file 1]. Therefore, it was sought to identify the sibling-species of An. fluviatilis prevalent in the region to determine the cause of low malaria incidence despite the high prevalence of these mosquitoes.


  Material & Methods Top


Study sites

Himachal Pradesh is a hilly state of India located in the north-western part of the Himalayas. Despite high mountain ranges, a large part of Himachal Pradesh lies between the altitudes of 350m to 1500m and has a climate like that of the plains (sub-tropical monsoon and severe summers etc.). Anopheline mosquitoes were collected from six villages (elevation range 0-300 m) under three PHC’s of district Kangra, Himachal Pradesh [Figure 1].
Figure 1: Map of Himachal Pradesh, India showing the collection sites/ villages in Kangra district.

Click here to view


Generation of entomological data

Fortnightly entomological surveys were carried out at all the selected localities. Data of larval density and adult vector was generated as per standard study protocols[6].

Mosquito collection

Human dwellings and cattle sheds were targeted to collect anopheline mosquitoes using mouth aspirator [Supplementary Figures S1] [Additional file 2] and [Supplementary Figures S2] [Additional file 3] aided by torchlight between 0600 and 0800 h for 1 hour as per standard WHO techniques[6]. Adult mosquitoes were morphologically distinguished to the species level using standard taxonomic keys[7] and were later used for molecular studies.

Ethical statement:

The study was approved by NIMR-Institutional Ethical Committee (ECR/65/Inst/DL/2013).

Sample preparation

Dried mosquitoes were processed for molecular analyses. The abdominal part of the mosquitoes was used for DNA extraction and identification of sibling species of An. fluviatilis using multiplex PCR[8]. The rest of the body parts (heads and thorax) were used for identification of circumsporozoite protein (CSP) of Plasmodium falciparum (Pf and Plasmodium vivax (Pv210 and Pv247) using ELISA[9]. Both DNA extraction (using abdomen) and ELISA (using head and thorax) were carried out in pools of a maximum of 10 mosquitoes as per the protocol.

DNA extraction and PCR with universal primers

DNA extraction was done using the commercial kit (Qiagen, USA), as per the manufacturer’s protocol. DNA was extracted in 100 μL of elution buffer and stored at -20°C and later was used for conventional PCR. The conserved D3 domain of 28S rDNA region was amplified using primers D3A: GACCCGTCTTGAAACACGGA and D3B: TCGGAAGGAACCAGCTACTA by PCR[8].

Each PCR was performed in 25.0 μl reaction mixtures in 200 μL PCR tubes. The master mix included: 10 X PCR buffer with MgCl2: 2.5 μL, dNTP mix (2.5 mM each): 2.0 μL, forward primer 10 μM: 1.0 μl, reverse primer 10 μM:1.0 μL, template DNA (lysate): 2.5 μL, sterile water: 15.8 μL, Taq polymerase (5 U/ μL): 0.2 μL. The PCR thermocycling conditions were as follows: initial denaturation step at 94°C for 5 min for a single cycle, followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 48°C for 60 sec, extension at 72°C for 30 sec, final extension at 72°C for 7 mins and a hold step at 4°C. PCR products were checked on 1.5% agarose gel using electrophoresis at 100 volts with 15mA current in an 18-slot apparatus for 30 min and visualized on gel documentation system. A molecular marker of 100bp was used as a standard for analyses of PCR product.

Allele-specific PCR

Identification of sibling-species of An. fluviatilis was done using primers; AFS: TGGAAACCCACAGGCAC and AFT: TACCCGTAATCCCGCAC[8]. Amplification was performed at 55°C for 30 sec and the rest of the steps were same as mentioned above.

ELISA for CSP

Enzyme-linked immunosorbent assay was performed on field-collected An. fluviatilis using CS-ELISA reagent kit as per the manufacturer’s protocol (BEI Resources, USA). A total of 3790 (in four batches of 890, 1130, 890 and 880 samples) An. fluviatilis were screened for the presence of circumsporozoite antigen of Plasmodium falciparum and Plasmodium vivax. Positive control was provided in the kit whereas insectary raised mosquitoes were used as the negative control. The sensitivity and specificity of the ELISA were based on the monoclonal antibodies (mAbs) used.

ELISA plates were coated with 50μL capture mAB and incubated for half an hour at room temperature, wells were aspirated and filled with 200μL blocking buffer (BB). Wells were aspirated again, mosquito samples were ground and 50 μL of mosquito titrate was sandwiched between capture monoclinal antibody and peroxidase labelled monoclonal antibody on separate 96 well ELISA plates. Plates were washed twice with 200 μLPBS -0.05% Tween20 solution after aspiration of wells each time. 50 μL peroxidase- mAb was added and 2,2›-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid] (ABTS) substrate was mixed in 1:1 ratio followed by incubation for one hour in dark. Again, wells were aspirated and washed 3 times with 200 μL PBS- 0.05% Tween 20 solution. 100 μL substrate was added in each well and incubated for half an hour in the dark. ELISA plate results were taken at 405-414 nm using Microskan spectrum (Thermo Scientific, USA). The intensity of the colour developed was directly proportional to the amount of CS antigen present in the samples [Supplementary Table S2] [Additional file 4].

Host-blood meal analysis

Blood meal analysis was done for field-collected mosquitoes using dried blood spots. DNA was extracted and PCR was performed with human and cattle primers[10].

Sequencing

Sequencing was performed commercially (Eurofins, Bangalore, India) for positive PCR products in both the directions (forward and reverse) using the same set of primers as mentioned above. The sequences were edited using Justbio online tool (www.justbio.com/hosted-tools. html) and aligned using multiple sequence alignment program of Clustal Omega online tool (version 1.2.4). The sequences generated from the study were analysed using the Basic Local Alignment Search Tool (BLAST) and deposited in the GenBank database of the National Centre for Biotechnology Information (NCBI) and accession numbers were obtained.

Entomological survey of the selected study sites revealed that An. fluviatilis was the most pre-dominant vector species (69.5%) followed by An. culicifacies (14.61%). The remaining field-collected mosquitoes (15.89%) were non-vectors. An. fluviatilis and An. culicifacies were identified as the main malaria vector species in the study villages. Mosquito density per hour (MHD) of An. fluviatilis was higher than An. culicifacies during the study period [Figure 2]. In village Tarshu and Lulehar, highest MHD was 31.6 and 38 respectively in September 2018. In villages Mundla, Sunehar, Upper Dhob and Lower Dhob highest MHD was seen in May 2019 with 39.25, 42.75, 46.5 and 35 respectively. Mosquitoes were mostly prevalent in cattle sheds (~90%) and recorded density varied from 35.5-92.5. Only a small percentage of the mosquitoes were found in human dwellings (MHD 2.5-5).
Figure 2: The relative abundance of Anopheles fluviatilis and Anopheles culicifacies mosquitoes in the study villages of Kangra district, Himachal Pradesh.

Click here to view


PCR for sibling-species

A total of 900 An. fluviatilis were screened by allele-specific PCR assay for the identification of sibling-species as per established study protocol[8]. Two sets of primers, i.e., D3A/ D3B (universal primers) and AFS/AFT were used in multiple combinations to identify three sibling species of An. fluviatilis. The analysis revealed the predominance of sibling species U [830 (92.22%)] followed by T species [70 (7.78%)]. A representative photograph of the gel is shown in [Figure 3]a and [Figure 3]b.
Figure 3: Multiplex PCR for Anopheles fluviatilis sibling specific genes (S, T and U).

Click here to view


ELISA

Initial observation of the ELISA plates did not show a considerable change in colour for any of the 3790 mosquito samples tested. Visual reading of the ELISA plate at 405–414 nm revealed that the absorbance for each sample was similar to that of the negative control; indicating the absence of circumsporozoite antigen in all samples. Hence, zero sporozoite infectivity rate was detected in field-collected mosquitoes in study villages of Kangra. A total of 220 blood spots were analysed including 201 An. fluviatilis and 19 An. culicifacies mosquitoes. All An. culicifacies were zoophagic while among An. fluviatilis, 6 were anthropophagic and 195 were zoophagic. This revealed that prevalent vector species populations were mainly zoophagic.

Sequencing analysis

The length of amplified PCR products with universal primers were in the range of 310 to 330 nucleotides. Accession numbers obtained were MK281594 for species T and MK281596 and MK281597, for species U. At position 92, sequences of sibling species T have nucleotide “G’ in place of nucleotides A and T in species U and S respectively [Figure 4].
Figure 4: Multiple Sequence alignment of Anopheles fluviatilis sibling-species using Clustal Omega. Sequence 1 and 2 corresponds to sibling species T, sequences 3-6 belonged to sibling species U and sequence 7 corresponds to sibling species S (extracted from NCBI). Three sibling species differ by only a single nucleotide at position 72 while species S differs from species T and U at two nucleotide position 76 and 77 (encircled).

Click here to view



  Discussion Top


The National Vector Borne Disease Control Programme (NVBDCP) of India reports an exceptionally low prevalence of malaria in Himachal Pradesh particularly in Kangra valley[11]. However, regular entomological surveys in the region revealed a high density of An. fluviatilis, a species that has been implicated as a major vector of malaria, not only in India but also its neighbouring countries in eastern and western Asia[12]. A large difference in the MHD of An. fluviatilis in cattle sheds and human dwellings suggests zoophagic nature of prevalent populations of An. fluviatilis mosquitoes in Kangra valley as mentioned in previous studies as well[13],[14].

Detection of sibling-species U as a predominant type of An. fluviatilis validates the absence of malarial parasite by ELISA as it is a non-vector species. Presence of sibling species T and U in this area with zero sporozoite rates indicated that these species might be playing a negligible role in malaria transmission. Our findings are following a previous study which showed the presence of sibling species T and U and absence of species S[15]. In India, species S is mainly found in Odisha[16], T is the most widely distributed species in Uttar Pradesh, Gujarat, Madhya Pradesh, Odisha, and Rajasthan[8] and species U is mainly found in Uttar Pradesh[17]. On the contrary, some previous studies experimentally proved sibling species T and species U as sibling-species capable of supporting malaria sporogony development[13],[18], which highlights the significance of proper surveillance and control strategies for control of An. fluviatilis to prevent it from emerging as a potential vector in hilly areas.

Absence of CSP can be explained by the fact that since CS protein can be present at multiple locations like developing oocyst, haemolymph, sporozoites (hemocoel) or in salivary glands, this could be one of the possible reasons for their absence in malaria-infected mosquitoes.

Sequence analysis revealed 99% similarity between sibling species T and U and they differ by single nucleotide base which appeared to be an important factor in their similar genetic characteristics and hence, a similar role in malaria transmission (non-vector). Although, the sequence of the conserved region of sibling species S differed from species T and U by two base pairs (when compared with sequences present in the database) which is making it a potential vector. Due to approximately 99% similarity in sequences of three sibling species, it appears that in future they may evolve together (as potential malaria vectors) under favourable conditions.


  Conclusion Top


This study demonstrated that the mere presence of non-vector sibling species is not sufficient to support disease transmission. Initial observations revealed that sibling species T and U were mainly of zoophagic nature that established them as a non-vector. Since An. fluviatilis was predominant in our study area, their contact with humans can be found out by their blood meal analysis to know the feeding preferences of their sibling complex. Sibling species U of An. fluviatilis was found in abundance and some T in lower hills of Kangra which may emerge as species capable of malaria transmission with their changing feeding habits, however, further investigations are required to determine their exact role in disease transmission. The similarity in sequences of three sibling species emphasizes the requirement of proper surveillance and control strategies for An. fluviatilis to prevent it from emerging as a potential vector in hilly areas.

Conflict of interest: None

 
  References Top

1.
WHO. 2015. World malaria report 2015. World Health Organization, Geneva.  Back to cited text no. 1
    
2.
Dev V, Sharma VP (2013) The Dominant Mosquito Vectors of Human Malaria in India, In: Anopheles mosquitoes - New insights into malaria vectors, Sylvie Manguin (Ed.), InTech Open, Croatia, pp. 239–271.  Back to cited text no. 2
    
3.
Fontenille D, Louchouarn L. The complexity of the malaria vectorial system in Africa. Parassitologia 1999; 41(1-3): 267–71.  Back to cited text no. 3
    
4.
Sharma VP. Fighting malaria in India. Curr Sci 1998; 75(11): 1127–140.  Back to cited text no. 4
    
5.
Nanda N, Yadav RS, Subbarao SK, Joshi H, Sharma VP. Studies on Anopheles fluviatilis and Anopheles culicifacies sibling species in relation with malaria in forested hilly and deforested riverine eco-systems in northern Orissa in India. J Am Mosq Control Assoc 2000; 16(3): 199–05.  Back to cited text no. 5
    
6.
World Health Organization, 1975. Manual on Practical Entomology in Malaria, Part II. World Health Organization offset publication, Geneva, pp. 13.  Back to cited text no. 6
    
7.
Nagpal BN, Sharma VP. Indian Anophelines. Oxford and IBH Publishing Co. Pvt Ltd, Mohan Primlani, N Delhi. 1995.  Back to cited text no. 7
    
8.
Singh OP, Chandra D, Nanda N, Raghavendra K, Sunil S, Sharma SK, et al. Differentiation of members of the Anopheles fluviatilis species complex by an allele-specific polymerase chain reaction based on 28S ribosomal DNA sequences. Am J Trop Med Hyg 2004; 70(1): 27–32.  Back to cited text no. 8
    
9.
Wirtz RA, Burkot TR, Graves PM, Andre RG. Field evaluation of enzyme linked immunosorbent assays for Plasmodium falciparum and Plasmodium vivax sporozoites in mosquitoes (Diptera: culicidae) from Papua New Guinea. J. Med. Entomol 1987; 24(4): 433–37.  Back to cited text no. 9
    
10.
Rath A, Prusty MR, Das M, Mahapatra N, Tripathy H, Hazra RK. A shift in resting habitat and feeding behavior of Anopeles fluviatilis sibling species in the Keonjhar district of Odisha, India. Trans R Soc Trop Med Hyg 2015; 109(11): 730–7.  Back to cited text no. 10
    
11.
National Vector Borne Disease Control Programme Annual Report 2014–15. Delhi, Directorate General of Health Services, Ministry of Health and Family Welfare, Government of India. Available from: http://nvbdcp.gov.in/Doc/ Annual-report-NVB-DCP-2014-15.pdf (Accessed on January 31, 2017).  Back to cited text no. 11
    
12.
Rao TR. The Anophelines of India. New Delhi: Malaria Research Centre, Indian Council of Medical Research. (1984).  Back to cited text no. 12
    
13.
Adak T, Singh OP, Das MK, Wattal S, Nanda N. Comparative susceptibility of three important malaria vectors Anopheles stephensi, Anopheles fluviatilis, and Anopheles sundaicus to Plasmodium vivax. J Parasitol 2005; 91(1): 79–2.  Back to cited text no. 13
    
14.
Nanda N, Joshi H, Subbarao SK, Yadav RS, Shukla RP, Dua VK et al. Anopheles fluviatilis complex: host feeding patterns of species S.T and U. 1996; J Am Mosq Control Assoc 1996; 12(1): 147–9.  Back to cited text no. 14
    
15.
Shukla RP, Nanda N, Pandey AC, Kohli VK, Joshi H, Subbarao SK. Studies on bionomics of Anopheles fluviatilis and its sibling species in Nainital District, UP. Indian J Malariol 1998; 35(2): 41–7.  Back to cited text no. 15
    
16.
Manonmani A, Townson H, Adeniran T, Jambulingam P, Sahu S, Vijayakumar T. rDNA-ITS2 polymerase chain reaction assay for the sibling species of Anopheles fluviatilis. Acta Trop 2001; 78(1): 3–9.  Back to cited text no. 16
    
17.
Chen B, Butlin RK, Pedro PM, Wang XZ, Harbach RE. Molecular variation, systematics and distribution of the Anopheles fluviatilis complex in southern Asia. Med. Vet. Entomol 2006; 20(1): 33–43.  Back to cited text no. 17
    
18.
Mehrunissa A, Sharma A, Parasher H, Dhayal D, Singh OP, Nanda N, et al. Comparative susceptibilities of species T and U of the Anopheles fluviatilis complex to Plasmodium vinckei petteri sporogony. J Med Entomol 2013; 50(3): 594–97.  Back to cited text no. 18
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Material & M...
Discussion
Conclusion
References
Article Figures

 Article Access Statistics
    Viewed365    
    Printed0    
    Emailed0    
    PDF Downloaded25    
    Comments [Add]    

Recommend this journal